Prev. |  KEGG KO K10749 > 

RIKEN DNA Bank Human Resource - GMNN

Gene ID NCBI Gene 51053 |  KEGG hsa:51053
Gene Symbol GMNN
Protein Name geminin, DNA replication inhibitor
Synonyms Gem|MGORS6
Ortholog resources KEGG ortholog (KEGG orthology K10749) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB15269 mCherry-hGeminin(1/110) / pCSII-EF Lentivirus vector construct of S/G2/M-R(N).
RDB15270 mCherry-hGeminin(1/60) / pCSII-EF Lentivirus vector construct of S/G2/M-R(NC).
RDB15271 mVenus-hGeminin(1/110) / pCSII-EF Lentivirus vector construct of Fucci2-S/G2/M phase probe. Component of Fucci2 cell cycle probe.
RDB15272 mVenus-hGeminin(1/60) / pCSII-EF Lentivirus vector construct of S/G2/M-Y(NC).
RDB15277 mAG-hGeminin (1/60) / pT2KXIGdeltain hGem-based S/G2/M marker. for zebrafish cells to label nuclei with green fluorescent protein mAG.
RDB15458 mVenus-hGeminin(1/110)/pcDNA3 Expression vector of Fucci2-S/G2/M phase probe. Component of Fucci2 cell cycle probe.
RDB15268 mAG-hGeminin(1/110) / pCSII-EF Lentivirus vector construct of mAG-hGeminin(1/110). Component of Fucci cell cycle probe.
RDB13080 pCAG-Fucci2a Fucci2a cell cycle reporter.
RDB13081 pROSA-floxNeo-Fucci2a Fucci2a cell cycle reporter. Targeting vector for R26 locus
RDB15443 tFucci(SA)2/pCSII-EF Lentivirus vector construct of mCherry-hCdt1(30/120)_P2A_mVenus-hGem(1/110). EF-1 alpha promoter.
RDB15445 tFucci(SA)2.2/pCSII-EF Lentivirus vector construct of mCherry-hCdt1(30/120)_P2A_mTurquoise-hGem(1/110). EF-1 alpha promoter.
RDB15446 tFucci(CA)2/pCSII-EF Lentivirus vector construct of mCherry-hCdt1(1/100)Cy(-)_P2A_mVenus-hGem(1/110). EF-1 alpha promoter.
RDB15448 tFucci(CA)2.2/pCSII-EF Lentivirus vector construct of mCherry-hCdt1(1/100)Cy(-)_P2A_mTurquoise-hGem(1/110). EF-1 alpha promoter.
RDB15449 tFucci(SA)2/pCSII-CMV Lentivirus vector construct of mCherry-hCdt1(30/120)_P2A_mVenus-hGem(1/110). CMV promoter.
RDB15451 tFucci(SA)2.2/pCSII-CMV Lentivirus vector construct of mCherry-hCdt1(30/120)_P2A_mTurquoise-hGem(1/110). CMV promoter.
RDB15452 tFucci(CA)2/pCSII-CMV Lentivirus vector construct of mCherry-hCdt1(1/100)Cy(-)_P2A_mVenus-hGem(1/110). CMV promoter.
RDB15454 tFucci(CA)2.2/pCSII-CMV Lentivirus vector construct of mCherry-hCdt1(1/100)Cy(-)_P2A_mTurquoise-hGem(1/110). CMV promoter.

RDB_org_190226.csv


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY086640 IRAL016J24 pDNR-LIB BC005185 NM_015895 Full
HGY086760 IRAL016O24 pDNR-LIB BC005389 NM_015895 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR046484 ARe16D12 pKA1U5 NM_015895.3  
GGTTCGGAGCGGGCGAGCGGAGTTAGCAGGGCTTTNCTGCAGAGCGCGCCGGGCACTCCA
HKR075632 ARe89B08 pKA1U5 NM_015895.3  
GAGTTGGTCACGTGGTTGTTCGGAGCGGGCGAGCGGAGTTAGCAGGGCTTTACTGCAGAG
HKR405236 RBdS013B12 pGCAP10 NM_015895.3  
GAGAGCGCGCCGGGCACTCCAGCGACCGTGGGGATCAGCGTAGGTGAGCTGTGGCCTTTT
HKR405413 RBdS013I21 pGCAP10 NM_015895.3  
GAGCAGGGCTTTACTGCANAGCGCGCCGGGCACTCCAGCGACCGTGGGGATCAGCGTAGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.10.31

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_190501.pl