DNA Bank Top |  KEGG KO K10749 > 

RIKEN DNA Bank Human Resource - GMNN

Gene ID NCBI Gene 51053 |  KEGG hsa:51053
Gene Symbol GMNN
Protein Name geminin DNA replication inhibitor
Synonyms Gem|MGORS6

Link

Ortholog resource in our bank

  GMNN

External database

human GMNN

Individualy Deposited Resource

Catalog number Name of Resource Description CDS comparison
Refered (NCBI mRNA) CDS status(1)
RDB18221 tFucci(CA)5/pCS2 New color variant of Fucci: Fucci(CA)5.    
RDB18220 tFucci(SA)5/pCS2 New color variant of Fucci: Fucci(SA)5.    
RDB17826 pLBS.EF/miRFP670-hGem110Nt Cell cycle reporter, lentivirus    
RDB16059 pCAG-Arl13bCerulean-Fucci2a Mammalian expression construct of Arl13bCerulean-Fucci2a    
RDB16058 pRosa26-CAG-floxNeo-Arl13bCerulean-Fucci2a Rosa26 ES cell targeting construct of Arl13bCerulean-Fucci2a.    
RDB16057 pCDNA5-Frt-CAG-Arl13bCerulean-Fucci2a Flp/In targeting construct of Arl13bCerulean-Fucci2a    
RDB16056 pCDNA5-Frt-Fucci2a Flp/In targeting construct of Fucci2a    
RDB15458 mVenus-hGeminin(1/110)/pcDNA3 Expression vector of Fucci2-S/G2/M phase probe. Component of Fucci2 cell cycle probe.    
RDB15454 tFucci(CA)2.2/pCSII-CMV Lentivirus vector plasmid of mCherry-hCdt1(1/100)Cy(-)_P2A_mTurquoise-hGem(1/110). CMV promoter.    
RDB15453 tFucci(CA)2.1/pCSII-CMV Lentivirus vector plasmid of mCherry-hCdt1(1/100)Cy(-)_P2A_AmCyan-hGem(1/110). CMV promoter.    
RDB15452 tFucci(CA)2/pCSII-CMV Lentivirus vector plasmid of mCherry-hCdt1(1/100)Cy(-)_P2A_mVenus-hGem(1/110). CMV promoter.    
RDB15451 tFucci(SA)2.2/pCSII-CMV Lentivirus vector plasmid of mCherry-hCdt1(30/120)_P2A_mTurquoise-hGem(1/110). CMV promoter.    
RDB15450 tFucci(SA)2.1/pCSII-CMV Lentivirus vector plasmid of mCherry-hCdt1(30/120)_P2A_AmCyan-hGem(1/110). CMV promoter.    
RDB15449 tFucci(SA)2/pCSII-CMV Lentivirus vector plasmid of mCherry-hCdt1(30/120)_P2A_mVenus-hGem(1/110). CMV promoter.    
RDB15448 tFucci(CA)2.2/pCSII-EF Lentivirus vector plasmid of mCherry-hCdt1(1/100)Cy(-)_P2A_mTurquoise-hGem(1/110). EF-1 alpha promoter.    
RDB15447 tFucci(CA)2.1/pCSII-EF Lentivirus vector plasmid of mCherry-hCdt1(1/100)Cy(-)_P2A_AmCyan-hGem(1/110). EF-1 alpha promoter.    
RDB15446 tFucci(CA)2/pCSII-EF Lentivirus vector plasmid of mCherry-hCdt1(1/100)Cy(-)_P2A_mVenus-hGem(1/110). EF-1 alpha promoter.    
RDB15445 tFucci(SA)2.2/pCSII-EF Lentivirus vector plasmid of mCherry-hCdt1(30/120)_P2A_mTurquoise-hGem(1/110). EF-1 alpha promoter.    
RDB15444 tFucci(SA)2.1/pCSII-EF Lentivirus vector plasmid of mCherry-hCdt1(30/120)_P2A_AmCyan-hGem(1/110). EF-1 alpha promoter.    
RDB15443 tFucci(SA)2/pCSII-EF Lentivirus vector plasmid of mCherry-hCdt1(30/120)_P2A_mVenus-hGem(1/110). EF-1 alpha promoter.    
RDB15277 mAG-hGeminin (1/60) / pT2KXIGdeltain hGem-based S/G2/M marker. for zebrafish cells to label nuclei with green fluorescent protein mAG.    
RDB15272 mVenus-hGeminin(1/60) / pCSII-EF Lentivirus vector plasmid of S/G2/M-Y(NC).    
RDB15271 mVenus-hGeminin(1/110) / pCSII-EF Lentivirus vector plasmid of Fucci2-S/G2/M phase probe. Component of Fucci2 cell cycle probe.    
RDB15270 mCherry-hGeminin(1/60) / pCSII-EF Lentivirus vector plasmid of S/G2/M-R(NC).    
RDB15269 mCherry-hGeminin(1/110) / pCSII-EF Lentivirus vector plasmid of S/G2/M-R(N).    
RDB15268 mAG-hGeminin(1/110) / pCSII-EF Lentivirus vector plasmid of mAG-hGeminin(1/110). Component of Fucci cell cycle probe.    
RDB13081 pROSA-floxNeo-Fucci2a Fucci2a cell cycle reporter. Targeting vector for R26 locus    
RDB13080 pCAG-Fucci2a Fucci2a cell cycle reporter.    

(1) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.

webcatalog20240727.tab

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY086640 IRAL016J24 pDNR-LIB BC005185 NM_015895 Full
HGY086760 IRAL016O24 pDNR-LIB BC005389 NM_015895 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2024May11.csv
GNP_full_IRAL_2024May11.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR046484 ARe16D12 pKA1U5 NM_015895.3  
GGTTCGGAGCGGGCGAGCGGAGTTAGCAGGGCTTTNCTGCAGAGCGCGCCGGGCACTCCA
HKR075632 ARe89B08 pKA1U5 NM_015895.3  
GAGTTGGTCACGTGGTTGTTCGGAGCGGGCGAGCGGAGTTAGCAGGGCTTTACTGCAGAG
HKR405236 RBdS013B12 pGCAP10 NM_015895.3  
GAGAGCGCGCCGGGCACTCCAGCGACCGTGGGGATCAGCGTAGGTGAGCTGTGGCCTTTT
HKR405413 RBdS013I21 pGCAP10 NM_015895.3  
GAGCAGGGCTTTACTGCANAGCGCGCCGGGCACTCCAGCGACCGTGGGGATCAGCGTAGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2024May11.csv
NRCDhumcloneList_RB_2024May11.csv

2024.11.27

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_240727.pl