Prev. |  KEGG KO K14821 > 

RIKEN DNA Bank Human Resource - ZNF593

Gene ID NCBI Gene 51042 |  KEGG hsa:51042
Gene Symbol ZNF593
Protein Name zinc finger protein 593
Synonyms ZT86
Ortholog resource in our bank

  ZNF593

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY081686 IRAL004D14 pOTB7 BC002580 NM_015871 Full
HGY083758 IRAL009G14 pOTB7 BC019267 NM_015871 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE000597 W01A001I05 pENTR-TOPO IRAL009G14 BC019267 NM_015871  
HGE000599 W01A001I07 pENTR-TOPO IRAL009G14 BC019267 NM_015871  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR208107 ARiS020E11 pGCAP10 NM_015871.4  
CGGCCGGCCGATGACACGTGTGCTCCCTGCCCTGCTCCTGGCCCCTTGGCCGGCCGGGCT
HKR243759 ARiS109G15 pGCAP10 NM_015871.4  
GCCCGGNATTGNTCACACGTGTGCTCCCTGCCCTGCTCCTGGCCCCTTGGCCGGCCGGGC
HKR247508 ARiS118M20 pGCAP10 NM_015871.4  
GACACGTGTGCTCCCTGCCCTGCTCCTGGCCCCTTGGCCGGCCGGGCTGTTTCTGGCCAT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl