Prev. | 

RIKEN DNA Bank Human Resource - UBXN1

Gene ID NCBI Gene 51035 |  KEGG hsa:51035
Gene Symbol UBXN1
Protein Name UBX domain protein 1
Synonyms 2B28|SAKS1|UBXD10
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX001451 IRAK003K11 pCMV-SPORT6 BC000902 NM_015853 Partial/var
HGX033972 IRAK084P12 pCMV-SPORT6 BC040129 NM_015853 Partial/var
HGY081717 IRAL004E21 pOTB7 BC001372 NM_015853

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR053748 ARe34G04 pKA1U5 NM_015853.3  
GGCTTCCCCTCGGCTTTCTTCTCGTCGGTGTTCCCGTGCTGCTATAGAGCCGGGTCCCCG
HKR070572 ARe76H04 pKA1U5 NM_015853.3  
GCTTCTCGTCGGNGTTCCCGGCTGCTATAGANCCNTNAGAGAGAGCGAGCGCCCGTCGGC
HKR279440 ARiS198J24 pGCAP10 NM_015853.3  
TTGCTTCTCGTCGGTGTTCCCGGCTGCTATAGAGCCGGGTGAGAGAGCGAGCGCCCGTCG
HKR327681 RBb19D09 pKA1U5 NM_015853.3  
GGAGCGAGCGCCCGTCGGCGGGTGTCGAGGGCGGGTTGCCTCGCGCTGACCCTTCCCGCC
HKR382829 RBd57B05 pGCAP10 NM_015853.3  
GNTAGAGCCGGGTGAGAGAGCGAGCGCCCGTCGGCGGGTGTCGANNGCGGGTTGCCTCGC
HKR399657 RBd99C09 pGCAP10 NM_015853.3  
GAGAGCCGGGTGAGAGAGCGAGCGCCCGTCGGCGGGTGTCGAGGGCGGGTTGCCTCGCGC
HKR433539 RBdS083O03 pGCAP10 NM_015853.3  
GACTTCCGCTTCCCCTCGGCTTTCTTCTCGTCGGTGTTCCCGGCTGCTATAGAGCCGGGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.09

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl