Prev. | 

RIKEN DNA Bank Human Resource - GLOD4

Gene ID NCBI Gene 51031 |  KEGG hsa:51031
Gene Symbol GLOD4
Protein Name glyoxalase domain containing 4
Synonyms C17orf25|CGI-150|HC71
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX005093 IRAK012M05 pCMV-SPORT6 BC008605 NM_016080 Full/var
HGY095331 IRAL038F11 pDNR-LIB BC015848 NM_016080 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR051706 ARe29E10 pKA1U5 NM_016080.3  
GTGACGGCTGCGTGCGGCGGGAATCATGGCTGCTCGCAGAGCTCTGCACTTCGTATTCAA
HKR059326 ARe48F06 pKA1U5 NM_016080.3  
AGGCCNCCCGCAGAGCTCTGCACATTCCATATTCAAAGCTGGGAAACCGCCTTCCAGACG
HKR172075 ARi30D03 pGCAP10 NM_016080.3  
GGGGCTGTACGGTGCGCGTGACGGCTGCGTGCGGCGGGAATCATGGCTGCTCGCAGAGCT
HKR176859 ARi42C11 pGCAP10 NM_016080.3  
GTGACGGCTGCGTGCGGCGGGAATCATGGCTGCTCGCAGAGCTCTGCACTTCGTATTCAA
HKR234017 ARiS085A17 pGCAP10 NM_016080.3  
GGTGACGGCTGCGTGCGGCGGGAATCATGGCTGCTCGCAGAGCTCTGCACTTCGTATTCA
HKR343212 RBb58A12 pGCAP1 NM_016080.3  
TGGTGACGGCTGCGTGCGGCGGGAATCATGGCTGCTCGCAGAGCTCTGCACTTCGTATTC
HKR374903 RBd37E07 pGCAP10 NM_016080.3  
GGCGCCCTTCGTGGACTGGGCTGTACGGTGCGCGTGACGGCTGCGTGCGGCGGGAATCAT
HKR378482 RBd46D10 pGCAP10 NM_016080.3  
GGCGTGACGGCTGCGTGCGGCGGGAATCATGGCTGCTCGCAGAGCTCTGCACTTCGTATT
HKR402905 RBdS007E09 pGCAP10 NM_016080.3  
GAGTGACGTCACGGCCCGTGGCGCCCTTCGTGGACTGGGCTGTACGGTGCGCGTGACGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.09

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl