Prev. |  KEGG KO K17969 > 

RIKEN DNA Bank Human Resource - FIS1

Gene ID NCBI Gene 51024 |  KEGG hsa:51024
Gene Symbol FIS1
Protein Name fission, mitochondrial 1
Synonyms CGI-135|TTC11
Ortholog resources KEGG ortholog (KEGG orthology K17969) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY085459 IRAL013K19 pOTB7 BC003540 NM_016068 Full/var
HGY089578 IRAL023P18 pOTB7 BC009428 NM_016068 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE004300 W01A010M12 pENTR-TOPO IRAL013K19 BC003540 NM_016068  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR065328 ARe63F08 pKA1U5 NM_016068.2  
TAGGTCGTGCCAGCATCCGCCGGACGCCGGAAGTGGTTCTCCGCCCCTGCCACTGGGCCA
HKR070501 ARe76E05 pKA1U5 NM_016068.2  
GGGGCCATGGAGACTGTGGCACAGTAGACTGTNNCTGTGAGGCTCGCGGGGGCAGTGGCC
HKR180058 ARi50C10 pGCAP10 NM_016068.2  
GGTTCTCCGCCCCTGCCACTGGGCCATGGAGACTGTGGCACAGTAGACTGTAGTGTGAGG
HKR188123 ARi70F03 pGCAP10 NM_016068.2  
GGCCGGAAGTGGTTCTCCGCCCCTGCCACTGGGCCATGGAGACTGTGGCACAGTAGACTG
HKR203565 ARiS008P05 pGCAP10 NM_016068.2  
GCCCTGCCACTGGGCCATGGAGACTGTGGCACAGTAGACTGTAGTGTGAGGCTCGCGGGG
HKR336180 RBb40H12 pGCAP1 NM_016068.2  
GTAGACTGACGGGATCTGGGATCATGCAGGAGCTGTGAGCTCAGGGCGCTCCTCCAGCGG
HKR474872 RBdS187C24 pGCAP10 NM_016068.2  
GGGAAGTGGTTCTCCGCCCCTGCCACTGGGCCATGGAGACTGTGGCACAGTAGACTGTAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.09

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl