Prev. |  KEGG KO K03676 > 

RIKEN DNA Bank Human Resource - GLRX2

Gene ID NCBI Gene 51022 |  KEGG hsa:51022
Gene Symbol GLRX2
Protein Name glutaredoxin 2
Synonyms CGI-133|GRX2
Ortholog resources KEGG ortholog (KEGG orthology K03676) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX025160 IRAK062O24 pCMV-SPORT6 BC028113 NM_197962 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR186127 ARi65F07 pGCAP10 NM_016066.3  
GGGGCTCCCGGGATCCGCGGTGTCCGGCAGTAGAGCTCGCTGCAGATCCGGGCTCTGACC
HKR248995 ARiS122I03 pGCAP10 NM_016066.3  
GATCCGCGGTGTCCGGCAGTAGAGCTCGCTGCAGATCCGGGCTCTGACCATGATTTGGCG
HKR368924 RBd22F04 pGCAP10 NM_016066.3  
GAGTAGAGCTCGCTGCAGATCCGGGCTCTGACCATGATTTGGCGCCGCGCGGCGCTGGCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.09

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl