Prev. |  KEGG KO K07023 > 

RIKEN DNA Bank Human Resource - HDDC2

Gene ID NCBI Gene 51020 |  KEGG hsa:51020
Gene Symbol HDDC2
Protein Name HD domain containing 2
Synonyms C6orf74|CGI-130|NS5ATP2|dJ167O5.2
Ortholog resources KEGG ortholog (KEGG orthology K07023) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX001541 IRAK003O05 pCMV-SPORT6 BC003357 NM_016063 Full/var
HGX056571 IRAK141H03 pCMV-SPORT6 BC061520 NM_016063 Full/var
HGY067253 IRAK168C05 pBluescriptR BC066332 NM_016063 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR058504 ARe46E08 pKA1U5 NM_016063.2  
GAAAGAGATAGAAGAGTAAGAGGAGGGGGAAGACCNCNAGGGGANGGGGAGNANCTNCGA
HKR166554 ARi16G10 pGCAP10 NM_016063.2  
GAGCCGGGGTCGGTGGCCGCATGGCTTCGGTCTCCTCTGCGACCTTCTCGGGCCACGGGG
HKR321605 RBb04A05 pKA1U5 NM_016063.2  
GGCGGCCTGCTCCGCCCAGCCGGGGTCGGTGGCCGCATGGCTTCGGTCTCCTCTGCGACC
HKR327273 RBb18D01 pKA1U5 NM_016063.2  
GGGCCTGCTCCGCCCAGCCGGGGTCGGGTGGCCGCATGGCTTCGGTCTCCTCTGCGACCT
HKR344409 RBb61A09 pGCAP1 NM_016063.2  
GGGAAGTGGGGGAGGAGGAGGAGGATTGGAAGGGGAGGAGGAATAATAACTCAAGGGTCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.09

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl