Prev. |  KEGG KO K18463 > 

RIKEN DNA Bank Human Resource - WASHC3

Gene ID NCBI Gene 51019 |  KEGG hsa:51019
Gene Symbol WASHC3
Protein Name WASH complex subunit 3
Synonyms CCDC53|CGI-116
Featured content Endocytosis (human)
Ortholog resource in our bank

  WASHC3

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY087809 IRAL019I17 pDNR-LIB BC010889 NM_016053 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR321703 RBb04E07 pKA1U5 NM_016053.2  
GACCGGGTTGGGCGGGCCCCATCTGGGAGGGGTTTGTGGGTGAACTCGGGGTCCACCGCC
HKR336932 RBb42F12 pGCAP1 NM_016053.2  
GCTGGGAGGGGTTTGTGGGTGAACTCGGGGTCCACCGCCCGCTGAGGAGATGGATGAGGA
HKR389681 RBd74D09 pGCAP10 NM_016053.2  
GATCTGGGAGGGGTTTGTGGGTGAACTCGGGGTCCACCGCCCGCTGAGGAGATGGATGAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl