Prev. | 

RIKEN DNA Bank Human Resource - RRP15

Gene ID NCBI Gene 51018 |  KEGG hsa:51018
Gene Symbol RRP15
Protein Name ribosomal RNA processing 15 homolog
Synonyms CGI-115|KIAA0507
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY095134 IRAL037N22 pDNR-LIB BC020641 NM_016052 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR010153 ARa25G09 pKA1U5 NM_016052.3  
GGGCGCAGAAAAATGGCAGCCGCCGCTCCGGACTCACGTTGTTGAGTGAGGAAGAAAACC
HKR366001 RBd15A01 pGCAP10 NM_016052.3  
GCGGCGCAGAAAAATGGCAGCCGCCGCTCCGGACTCACGTGTGAGTGAGGAAGAAAACCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl