Prev. |  KEGG KO K20349 > 

RIKEN DNA Bank Human Resource - TMED7

Gene ID NCBI Gene 51014 |  KEGG hsa:51014
Gene Symbol TMED7
Protein Name transmembrane p24 trafficking protein 7
Synonyms CGI-109|p24g3|p24gamma3|p27
Ortholog resource in our bank

  TMED7

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY087387 IRAL018H19 pOTB7 BC019349 NM_181836 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE019246 W01A048B22 pENTR-TOPO flj0018j17 AK074962 NM_181836  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR070546 ARe76G02 pKA1U5 NM_181836.5  
GGTCCGCCCGTCTGCGCCCCTCACAGGAAGCCCCCATTNAACGCTCTGATCCCGAATCTC
HKR187325 ARi68F05 pGCAP10 NM_181836.5  
GAGCTGGACCGCCCCGGCCCGCAGCGCCACGTCCCGGGTGGGGCCTGCCACGGCAAAGCA
HKR238683 ARiS096L19 pGCAP10 NM_181836.5  
GCTTTTCCGCTTCTCTTTTACCTCCCCAGGTCCGCCCGTCTGCGCCCCTCACAGGAAGCC
HKR276422 ARiS191A22 pGCAP10 NM_181836.5  
GAGGCCTTTTCCGCTTCTCTTTTACCTCCCCAGGTCCGCCCGTCTGCGCCCCTCACAGGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl