Prev. | 

RIKEN DNA Bank Human Resource - PRELID3B

Gene ID NCBI Gene 51012 |  KEGG hsa:51012
Gene Symbol PRELID3B
Protein Name PRELI domain containing 3B
Synonyms C20orf45|SLMO2|dJ543J19.5
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX005500 IRAK013M12 pCMV-SPORT6 BC010649 NM_016045 Full/var
HGY084820 IRAL012A20 pOTB7 BC013969 NM_016045 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR185212 ARi63A12 pGCAP10 NM_016045.2  
GGCCTGCGCACTGCGCCGCCGGCTGGGGTGCTGGGGGCGGGGCAGGNGCAGGTGTAGCCT
HKR205232 ARiS013B08 pGCAP10 NM_016045.2  
GGCGCCGCCGGCTGGGGTGCTGGGGGCGGGGCAGGGGCAGGTGTAGCCTCTGTGCCTCGT
HKR378921 RBd47F01 pGCAP10 NM_016045.2  
GGCTGGGGGCGGGGCAGGGGCAGGTGTAGCCTCTGTGCCTCGTTGTCCCCTGGCGCTACC
HKR406011 RBdS015A11 pGCAP10 NM_016045.2  
GGGGGTGCTGGGGGCGGGGCAGGGGCAGGTGTAGCCTCTGTGCCTCGTTGTCCCCTGGCG
HKR416372 RBdS040P12 pGCAP10 NM_016045.2  
GCTCTGTGCCTCGTTGTCCCCTGGCGCTACCCGGACATCTCTCAGGGTGCCGGCACCATG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.09

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl