Prev. |  KEGG KO K13989 > 

RIKEN DNA Bank Human Resource - DERL2

Gene ID NCBI Gene 51009 |  KEGG hsa:51009
Gene Symbol DERL2
Protein Name derlin 2
Synonyms CGI-101|DERtrin-2|F-LAN-1|F-LANa|FLANa|derlin-2
Ortholog resource in our bank

  DERL2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY087857 IRAL019K17 pDNR-LIB BC010890 NM_016041 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE037275 W01A093D03 pENTR-TOPO IRAL019K17 BC010890 NM_016041  
HGE045811 W01A114I19 pENTR-TOPO IRAL019K17 BC010890 NM_016041  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR276656 ARiS191K16 pGCAP10 NM_016041.3  
GGGGGCAGGCGACGGTGGGGAAGATGGCGTACCAGAGCTTGCGGCTGGAGTACCTGCAGA
HKR336930 RBb42F10 pGCAP1 NM_016041.3  
GGGGGCAGGCGACGGTGGGGAAGATGGCGTACCAGAGCTTGCGGCTGGAGTACCTGCAGA
HKR408878 RBdS022D06 pGCAP10 NM_016041.3  
GGGGTGGGGGGTGGGGCAGGCGACGGTGGGGAAGATGGCGTACCNGAGCTTGCGGCTGGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv

2023.04.25

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl