Prev. |  KEGG KO K15280 > 

RIKEN DNA Bank Human Resource - SLC35C2

Gene ID NCBI Gene 51006 |  KEGG hsa:51006
Gene Symbol SLC35C2
Protein Name solute carrier family 35 member C2
Synonyms BA394O2.1|C20orf5|CGI-15|OVCOV1
Ortholog resource in our bank

  SLC35C2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY092352 IRAL030O16 pOTB7 BC014191 NM_173073 Full
HGY096288 IRAL040L24 pOTB7 BC021138 NM_173179 Full
HGY096981 IRAL042H13 pOTB7 BC025277 NM_173179 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE024808 W01A062A08 pENTR-TOPO IRAL030O16 BC014191 NM_173073  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR205345 ARiS013G01 pGCAP10 NM_015945.10  
GGATTCCGGCCTGGANCTCCCAGGGCCGAGCAGACCTTGGGACCTGTGAGCGCTGCATCC
HKR234261 ARiS085K21 pGCAP10 NM_015945.10  
GGGTGGGGAGATTCCGGCCTGGAGCTCCCAGGGCCGAGCAGACCTTGGGACCTGTGAGCG
HKR339730 RBb49F10 pGCAP1 NM_015945.10  
GGGTGGGGAGATTCCGGCCTGGAGCTCCCAGGGCCGAGCNCCACTTTTGGGACCTGTGAG
HKR344098 RBb60E02 pGCAP1 NM_015945.10  
AAATGTGGGTGGGGAGATTCCGGCCTGGAGCTCCCAGGGCCGAGATTGAGTTGACAAGAA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl