Prev. |  KEGG KO K01443 > 

RIKEN DNA Bank Human Resource - AMDHD2

Gene ID NCBI Gene 51005 |  KEGG hsa:51005
Gene Symbol AMDHD2
Protein Name amidohydrolase domain containing 2
Synonyms CGI-14
Ortholog resource in our bank

  AMDHD2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY096251 IRAL040K11 pOTB7 BC018734 NM_015944

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR208100 ARiS020E04 pGCAP10 NM_015944.3  
GACTGGGCGCGGGATTTGGCCGCCGCGGGGCTCCGGAGCCGCTCGCTCCCGACACGGCTC
HKR277722 ARiS194F02 pGCAP10 NM_015944.3  
GATTTGGCCGCCGCGGGGCTCCGGAGCCGCTCGCTCCCGACACGGCTCACGATGCGCGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl