Prev. |  KEGG KO K15153 > 

RIKEN DNA Bank Human Resource - MED31

Gene ID NCBI Gene 51003 |  KEGG hsa:51003
Gene Symbol MED31
Protein Name mediator complex subunit 31
Synonyms 3110004H13Rik|CGI-125|Soh1
Ortholog resource in our bank

  MED31

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY087776 IRAL019H08 pDNR-LIB BC012539 NM_016060 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE000707 W01A001M19 pENTR-TOPO IRAL019H08 BC012539 NM_016060  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR184075 ARi60D03 pGCAP10 NM_016060.2  
GGTGGTTTCCGGAACTTCGCCCGCGTCTCTGGGCTTTTGCTCTGTCAGGCTGGTGGCGTT
HKR329653 RBb24C05 pGCAP1 NM_016060.2  
GGTGGCTTCCGGAACTTCGCCCGCGTCTCTGGGCTTTTGCTCTGTCAGGCTGGTGGCGTT
HKR461634 RBdS154B10 pGCAP10 NM_016060.2  
GGGTTTCCGGAACTTCGCCCGCGTCTCTGGGCTTTTGCTCTGTCAGGCTGGTGGCGTTTT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl