Prev. | 

RIKEN DNA Bank Human Resource - HEBP1

Gene ID NCBI Gene 50865 |  KEGG hsa:50865
Gene Symbol HEBP1
Protein Name heme binding protein 1
Synonyms HBP|HEBP
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX006023 IRAK015A23 pCMV-SPORT6 BC016277 NM_015987 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR057611 ARe44A11 pKA1U5 NM_015987.3  
ATCCTGGGCCGCCCTGCCGCCCTGCCGCCCTGCCGCCCTGCCGCCCTGCCGCCCTGCCGC
HKR238564 ARiS096G20 pGCAP10 NM_015987.3  
GGCCTCGCCGCCTCGCCGTCCCGCCGCCTTGCCGCCCTGCCACCCTGCCGCCCTGCNNNC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.09

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl