Prev. | 

RIKEN DNA Bank Human Resource - RNF141

Gene ID NCBI Gene 50862 |  KEGG hsa:50862
Gene Symbol RNF141
Protein Name ring finger protein 141
Synonyms RFP141|ZFP26|ZNF230
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX008816 IRAK022A16 pCMV-SPORT6 BC018104 NM_016422 Full
HGY029299 IRAK073E03 pBluescriptR BC035089 NM_016422 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR027324 ARa68F04 pKA1U5 NM_016422.3  
GGTGGGCTGAGGCAGCGCAGCCGCTGCCGCAGGGTGCGCGATGCCTTGAACCTGGGAAAC
HKR388002 RBd70A02 pGCAP10 NM_016422.3  
GGCAGGTCTGAGCTGTGGGCTGAGGCAGCGCAGCCGCTGCCGCAGGGTGCGCGATGCCTT
HKR389605 RBd74A05 pGCAP10 NM_016422.3  
GGCAGCCGCTGCCGCAGGGTGCGCGATGCCTTGAACCTGGGAAACTATGTGAAGCAACAC
HKR399702 RBd99E06 pGCAP10 NM_016422.3  
GGCAGCCGCTGCCGCAGGGTGCGCGATGCCTTGAACCTGGGAAACTATGTGAAGCAACAC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl