Prev. | 

RIKEN DNA Bank Human Resource - STMN3

Gene ID NCBI Gene 50861 |  KEGG hsa:50861
Gene Symbol STMN3
Protein Name stathmin 3
Synonyms SCLIP
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX027761 IRAK069G17 pCMV-SPORT6 BC032527 NM_015894 Full
HGX047917 IRAK119N05 pCMV-SPORT6 BC056873 NM_015894 Full
HGY090537 IRAL026F17 pOTB7 BC009381 NM_015894 Full
HGY097032 IRAL042J16 pOTB7 BC025234 NM_015894 Full
HGY103775 IRAL059H07 pOTB7 BC082248

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR369776 RBd24H08 pGCAP10 NM_015894.2  
GACCAGCCGTCTGCAGCTCCGGCCGCCACTTGCGCCTCTCCAGCCTCCGCAGGCCCAACC
HKR379701 RBd49E05 pGCAP10 NM_015894.2  
GGGCACTGCAGCACCAGCCGTCTGCAGCTCCGGCCGCCACTTGCGCCTCTCCAGCCTCCG
HKR470828 RBdS177B04 pGCAP10 NM_015894.2  
TGACTGCAGCNCCANCCGTCTGCAGCTCCGGCCGCCACTTGCGCCTCTCCAGCCTCCGNA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl