Prev. | Human A to Z list > N > 

RIKEN DNA Bank Human Resource - NSDHL

Gene ID (NCBI) 50814
Gene Symbol NSDHL
Protein Name NAD(P) dependent steroid dehydrogenase-like
Synonyms H105E3|SDR31E1|XAP104
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Ortholog resources in the DNA Bank (KEGG orthology K07748)


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB03722 SEREX clone NGO-St-034 (ID 255) #1 SEREX clone NGO-St-034 (ID 255) #1

RDB_org_170226.csv


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY082546 IRAL006G02 pOTB7 BC000245 NM_015922 Full
HGY088295 IRAL020M07 pOTB7 BC007816 NM_015922 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE014620 W01A036J04 pENTR-TOPO IRAL006G02 BC000245 NM_015922  
HGE014622 W01A036J06 pENTR-TOPO IRAL006G02 BC000245 NM_015922  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR260106 ARiS150E10 pGCAP10 NM_015922.2  
GGGGGAGTAAAGGGTGGCGGTCCGGGCCTGGAGTTCAGTGGGTGCAGCCTGCTTGCGAGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.08.24

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170416.pl