Prev. |  KEGG KO K07748 > 

RIKEN DNA Bank Human Resource - NSDHL

Gene ID NCBI Gene 50814 |  KEGG hsa:50814
Gene Symbol NSDHL
Protein Name NAD(P) dependent steroid dehydrogenase-like
Synonyms H105E3|SDR31E1|XAP104
Ortholog resource in our bank

  NSDHL

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB03722 SEREX clone NGO-St-034 (ID 255) #1 SEREX clone NGO-St-034 (ID 255) #1

webcatalog20220516.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY082546 IRAL006G02 pOTB7 BC000245 NM_015922 Full
HGY088295 IRAL020M07 pOTB7 BC007816 NM_015922 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Jun29.csv
GNP_full_IRAL_2023Jun29.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE014620 W01A036J04 pENTR-TOPO IRAL006G02 BC000245 NM_015922  
HGE014622 W01A036J06 pENTR-TOPO IRAL006G02 BC000245 NM_015922  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR260106 ARiS150E10 pGCAP10 NM_015922.2  
GGGGGAGTAAAGGGTGGCGGTCCGGGCCTGGAGTTCAGTGGGTGCAGCCTGCTTGCGAGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.10.11

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl