Prev. | 

RIKEN DNA Bank Human Resource - HDGFL3

Gene ID NCBI Gene 50810 |  KEGG hsa:50810
Gene Symbol HDGFL3
Protein Name HDGF like 3
Synonyms CGI-142|HDGF-2|HDGF2|HDGFRP3|HRP-3
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX009079 IRAK022L15 pCMV-SPORT6 BC015483 NM_016073 Full
HGY025575 IRAK063P15 pBluescriptR BC040554 NM_016073 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE045334 W01A113F14 pENTR-TOPO IRAK022L15 BC015483 NM_016073  
HGE045336 W01A113F16 pENTR-TOPO IRAK022L15 BC015483 NM_016073  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR168003 ARi20A03 pGCAP10 NM_016073.2  
GGACGCGGCGCTGGTGAGCAGCGCGCGCGGCGGCGGCGGCGNNGNCGGCGGCGGGGACCT
HKR209390 ARiS023H22 pGCAP10 NM_016073.2  
GAGACGCGAGGCCCGGCGCTCGCGCCGCGCCCGGGANCCCGGGAGGGAGACCGGCAGCGG
HKR408866 RBdS022C18 pGCAP10 NM_016073.2  
GATGCTGANCGCGCGCGAGAACAATAATAAGATCGTGTTTGCGGTCGCTGCCCGAGAAGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.09

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl