Prev. | 

RIKEN DNA Bank Human Resource - HP1BP3

Gene ID NCBI Gene 50809 |  KEGG hsa:50809
Gene Symbol HP1BP3
Protein Name heterochromatin protein 1 binding protein 3
Synonyms HP1-BP74|HP1BP74
Links

  KEGG gene

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR260320 ARiS150N08 pGCAP10 NM_016287.3  
GGGCTGGGACTGGAGGACNGCGGTGGCGGAGGCGACTAGCGGCGGCGGGAGCGGCGCCGA
HKR397729 RBd94F09 pGCAP10 NM_016287.3  
GATATCTCGGCGGCTGGGCCTGGAGGACAGGGGGGGCGGAGGCGACTAGCAGCGGCCGGA
HKR444331 RBdS110N19 pGCAP10 NM_016287.3  
GAGAGCTCGGCGGCTGGGACTGGAGGACAGCGGTGGCGGAGGCGACTAGCGGCGGCGGGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.03.25

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl