Prev. |  KEGG KO K11804 > 

RIKEN DNA Bank Human Resource - DCAF8

Gene ID NCBI Gene 50717 |  KEGG hsa:50717
Gene Symbol DCAF8
Protein Name DDB1 and CUL4 associated factor 8
Synonyms GAN2|H326|WDR42A
Ortholog resource in our bank

  DCAF8

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY103700 IRAL059E04 pOTB7 BC080597 NM_015726 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR203427 ARiS008J11 pGCAP10 NM_015726.3  
GAGTCTTCTCGAGCACATCGTCGCAAACGGGGCCGGAAAGCGTGGCAGCGCAGGCGCAAG
HKR388178 RBd70H10 pGCAP10 NM_015726.3  
GGCAGAGAGCGGAGGCGGTGGTGGTGGCGGCCGCTGGCCAGTGCTGGCTACAGCAAACAT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl