Prev. | 

RIKEN DNA Bank Human Resource - CYHR1

Gene ID NCBI Gene 50626 |  KEGG hsa:50626
Gene Symbol CYHR1
Protein Name cysteine and histidine rich 1
Synonyms CHRP
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY086267 IRAL015L03 pOTB7 BC004544 NM_032687 Partial/var
HGY087315 IRAL018E19 pOTB7 BC005073 NM_032687 Full
HGY100077 IRAL050D05 pOTB7 BC065484 NM_032687 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE098824 M01C047A24 pDONR221 MGC13-B12 BC005073 ENST00000306145  
HGE098872 M01C047C24 pDONR221 MGC13-B12 BC005073 ENST00000306145  
HGE098920 M01C047E24 pDONR221 MGC13-B12 BC005073 ENST00000306145  
HGE098968 M01C047G24 pDONR221 MGC13-B12 BC005073 ENST00000306145  
HGE099016 M01C047I24 pDONR221 MGC13-B12 BC005073 ENST00000306145  
HGE099064 M01C047K24 pDONR221 MGC13-B12 BC005073 ENST00000306145  
HGE099112 M01C047M24 pDONR221 MGC13-B12 BC005073 ENST00000306145  
HGE099160 M01C047O24 pDONR221 MGC13-B12 BC005073 ENST00000306145  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR391355 RBd78G11 pGCAP10 NM_032687.2  
GGCCCCGCCCCGGCCCTTCTCCCCTCATCACGCTCCTTCCAAACCACTATGCCCACGCAC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.09

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl