Prev. |  KEGG KO K06818 > 

RIKEN DNA Bank Human Resource - PODXL2

Gene ID NCBI Gene 50512 |  KEGG hsa:50512
Gene Symbol PODXL2
Protein Name podocalyxin like 2
Synonyms EG|PODLX2
Ortholog resources KEGG ortholog (KEGG orthology K06818) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY082716 IRAL006N04 pOTB7 BC019330 NM_015720 Full/var
HGY098975 IRAL047H07 pOTB7 BC052585 NM_015720 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR203233 ARiS008B09 pGCAP10 NM_015720.2  
AAGGCGGCGACGGCTACACCATGGGCCGGCTGCTGCGGGCCGCCCGGCTGCCGCCGCTGC
HKR366529 RBd16F09 pGCAP10 NM_015720.2  
GAGGCGGCGACGGCTACACCATGGGCCGGCTGCTGCGGGCCGCCCGGCTGCCGCCGCTGC
HKR398151 RBd95G07 pGCAP10 NM_015720.2  
GGCTGCGGCTGCAGGCGGCGACGGCTACACCATGGGCCGGCTGCTGCGGGCCGCCCGGCT
HKR403099 RBdS007M11 pGCAP10 NM_015720.2  
GGGCTGCAGGCGGCGACGGCTACACCATGGGCCGGCTGCTGCGGGCCGCCCGGCTGCCGC
HKR441684 RBdS104D12 pGCAP10 NM_015720.2  
GGCGCCGCTGCGGCTGCAGGCGGCGACGGCTACACCATGGGCCGGCTGCTGCGGGCCGCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.09

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl