Prev. | 

RIKEN DNA Bank Human Resource - STOML2

Gene ID NCBI Gene 30968 |  KEGG hsa:30968
Gene Symbol STOML2
Protein Name stomatin like 2
Synonyms HSPC108|SLP-2
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY082296 IRAL005M08 pOTB7 BC002442 NM_013442 Full
HGY083871 IRAL009L07 pOTB7 BC003025 NM_013442 Full
HGY090873 IRAL027D01 pOTB7 BC010152 NM_013442 Full/var
HGY093972 IRAL034P12 pOTB7 BC014990 NM_013442 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE006158 W01A015G14 pENTR-TOPO IRAL005M08 BC002442 NM_013442  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR075700 ARe89E04 pKA1U5 NM_013442.1  
GGGTTCCGGAGGTCGCTGCGGCGGTGGGAAATGCTGGCGCGCGCGGCGCGGGGCACTGGG
HKR249012 ARiS122I20 pGCAP10 NM_013442.1  
GGTTGGTTCCGGAGGTCGCTNCNNCNGNGGNAAANGNTGGCGCGCGCGANGCGGGGCACT
HKR249141 ARiS122O05 pGCAP10 NM_013442.1  
GGTTGGTTCCGGAGGTCGCTGCGGCGGTGGGAAATGCTGGCGCGCGCGGCGCGGGGCACT
HKR372426 RBd31B02 pGCAP10 NM_013442.1  
GGGGAAATGCTGGCGCGCGCGGCGCGGGGCACTGGGGCCCTTTTGCTGAGGGGCTCTCTA
HKR432660 RBdS081K20 pGCAP10 NM_013442.1  
GTCGTTGGTTCCGGAGGTCGCTGCGGCGGTGGGAAATGCTGGCGCGCGCGGCGCGGGGCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl