Prev. |  KEGG KO K12469 > 

RIKEN DNA Bank Human Resource - EHD2

Gene ID NCBI Gene 30846 |  KEGG hsa:30846
Gene Symbol EHD2
Protein Name EH domain containing 2
Synonyms PAST2
Featured content Endocytosis (human)
Ortholog resource in our bank

  EHD2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY093969 IRAL034P09 pOTB7 BC014445 NM_014601
HGY100328 IRAL050N16 pOTB7 BC062554 NM_014601 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR078036 ARe95B12 pKA1U5 NM_014601.3  
GGCTCCGGGCCCCACCCGGCTCAGACGGCTCCGGACGGGACCGCGAGCACAGGCCGCTCC
HKR161635 ARi04B11 pGCAP10 NM_014601.3  
GAGACGGCTCCGGACGGGACCGCGAGCACAGGCCGCTCCGCGGGCGCTTCGGATCCTCGC
HKR165301 ARi13E05 pGCAP10 NM_014601.3  
GAGACGGCTCCGGACGGGACCGCGAGCACAGGCCGCTCCGCGGGCGCTTCGGATCCTCGC
HKR171747 ARi29G03 pGCAP10 NM_014601.3  
GAGACGGCTCCGGACGGGACCGCGAGCACAGGCCGCTCCGCGGGCGCTTCGGATCCTCGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl