Prev. | 

RIKEN DNA Bank Human Resource - DNTTIP2

Gene ID NCBI Gene 30836 |  KEGG hsa:30836
Gene Symbol DNTTIP2
Protein Name deoxynucleotidyltransferase terminal interacting protein 2
Synonyms ERBP|FCF2|HSU15552|LPTS-RP2|TdIF2
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX039455 IRAK098K15 pCMV-SPORT6 BC047688 NM_014597 Partial/var
HGX047642 IRAK119B18 pCMV-SPORT6 BC063040 NM_014597 Full/var
HGY083252 IRAL008C04 pOTB7 BC001784 NM_014597 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR374577 RBd36H09 pGCAP10 NM_014597.3  
GAGCTTGGAAGAGGATCAACATGCCTTTGGCTAGAGATTTACTACATCCGTCCTTGGAAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl