Prev. |  KEGG KO K03000 > 

RIKEN DNA Bank Human Resource - ZNRD1

Gene ID NCBI Gene 30834 |  KEGG hsa:30834
Gene Symbol ZNRD1
Protein Name zinc ribbon domain containing 1
Synonyms HTEX-6|HTEX6|Rpa12|TCTEX6|TEX6|ZR14|hZR14|tctex-6
Ortholog resource in our bank

  ZNRD1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX044263 IRAK110K23 pCMV-SPORT6 BC050608 NM_170783 Full
HGY087780 IRAL019H12 pDNR-LIB BC010898 NM_170783 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR053609 ARe34A09 pKA1U5 NM_170783.2  
TGGGGGCGTTTCGGCTCCTTGGTCGCAGAGGCAGGAGGCGTGCGTGGCAGGAGGGTTCGG
HKR393370 RBd83H02 pGCAP10 NM_170783.2  
GAGGGTTCCAAGTCCTTTAGTACCCGACGCTGTCTGGGAATTCCGGGCGTTTCGGCTCCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl