Prev. | Human A to Z list > N > 

RIKEN DNA Bank Human Resource - NT5C

Gene ID (NCBI) 30833
Gene Symbol NT5C
Protein Name 5', 3'-nucleotidase, cytosolic
Synonyms DNT|DNT1|HEL74|P5N2|PN-I|PN-II|UMPH2|cdN|dNT-1
Databases KEGG link 01 |  NCBI Gene link 01


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX005082 IRAK012L18 pCMV-SPORT6 BC008183 NM_014595 Full/var
HGY081664 IRAL004C16 pOTB7 BC002516 NM_014595 Full/var
HGY091936 IRAL029N24 pOTB7 BC017454 NM_014595 Full
HGY094835 IRAL037B11 pDNR-LIB BC022334 NM_014595 Full/var

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


Genome Network Project (GNP) Gateway® Entry Clone link 01

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA
Clone ID Sequence (DDBJ)
HGE028534 W01A071F14 pENTR-TOPO flj0057k02 AK000419 NM_014595

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1)
5'-terminal sequence(2)
HKR080426 ARf01B02 pKA1U5 NM_014595.1
GGACAAAGGCTGGGTCCCGAAGAAGCGCAGGGNTCAGAAAAGTGCCCCCCAAAGCCGTCC
HKR370450 RBd26C02 pGCAP10 NM_014595.1
GCCGCTTCCGGCCGAGCCCGCGCCCCCCAGACCCCGAGAGCTCGCAGCTCCGGCCCGGCG
HKR416137 RBdS040F17 pGCAP10 NM_014595.1
GGCCCGCGCCCCCCAGACCCCGAGAGCTCGCAGCTCCGGCCCGGCGGCGATGGCGCGGAG
HKR475104 RBdS187M16 pGCAP10 NM_014595.1
GAGACCCCGAGAGCTCGCAGCTCCGGCCCGGCGGCGATGGCGCGGAGCGTGCGCGTGCTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.08.05

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_160505.pl