Prev. |  KEGG KO K14960 > 

RIKEN DNA Bank Human Resource - CXXC1

Gene ID NCBI Gene 30827 |  KEGG hsa:30827
Gene Symbol CXXC1
Protein Name CXXC finger protein 1
Synonyms 2410002I16Rik|5830420C16Rik|CFP1|CGBP|HsT2645|PCCX1|PHF18|SPP1|ZCGPC1|hCGBP
Ortholog resource in our bank

  CXXC1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX006362 IRAK015P02 pCMV-SPORT6 BC014940 NM_014593 Full/var
HGX020965 IRAK052G21 pCMV-SPORT6 BC029922 NM_014593 Partial
HGY093713 IRAL034E17 pOTB7 BC015733 NM_014593 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE025750 W01A064G06 pENTR-TOPO IRAK015P02 BC014940 NM_014593  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR123227 ARh08B03 pGCAP1 NM_014593.3  
GACGCCGCCGAGTGGTCTGTGCAGGTTCGCGGGTCGCTGGCGGGGGTCGTGAGG
HKR374432 RBd36B08 pGCAP10 NM_014593.3  
GGAAGCGGAAGTAGTTGTGGGCGCCTTTGCAACCGCCTGGGACGCCGCCGAGTGGTCTGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl