Prev. |  KEGG KO K03376 > 

RIKEN DNA Bank Human Resource - ST6GALNAC6

Gene ID NCBI Gene 30815 |  KEGG hsa:30815
Gene Symbol ST6GALNAC6
Protein Name ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 6
Synonyms SIAT7-F|SIAT7F|ST6GALNACVI
Ortholog resource in our bank

  ST6GALNAC6

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY019415 IRAK048I23 pBluescriptR BC036102 NM_013443 Full/var
HGY081366 IRAL003G22 pOTB7 BC006564 NM_013443 Full
HGY083110 IRAL007M22 pOTB7 BC016299 NM_013443
HGY088161 IRAL020G17 pOTB7 BC007802 NM_013443 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE113631 M01C084B07 pDONR221 IMS05-G04 BC016299 NM_013443  
HGE113679 M01C084D07 pDONR221 IMS05-G04 BC016299 NM_013443  
HGE113727 M01C084F07 pDONR221 IMS05-G04 BC016299 NM_013443  
HGE113775 M01C084H07 pDONR221 IMS05-G04 BC016299 NM_013443  
HGE113823 M01C084J07 pDONR221 IMS05-G04 BC016299 NM_013443  
HGE113871 M01C084L07 pDONR221 IMS05-G04 BC016299 NM_013443  
HGE113919 M01C084N07 pDONR221 IMS05-G04 BC016299 NM_013443  
HGE113967 M01C084P07 pDONR221 IMS05-G04 BC016299 NM_013443  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR219654 ARiS049C06 pGCAP10 NM_013443.3  
GGAGGCCTGGGCGGCCTGAGGAGCGCGGACCCCGGCGCTCGGCTCCCGGCGCCATGTGAG
HKR340874 RBb52D02 pGCAP1 NM_013443.3  
GTCCCGGCGCCATGTGAGGGGGCTCGGGGGCCGCGGGGGGCCTNGCGCTCCCCGCCGGAN

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl