Prev. | Human A to Z list > G > 

RIKEN DNA Bank Human Resource - GLTSCR2

Gene ID (NCBI) 29997
Gene Symbol GLTSCR2
Protein Name glioma tumor suppressor candidate region gene 2
Synonyms PICT-1|PICT1
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Ortholog resources in the DNA Bank (KEGG orthology K14840)


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX033607 IRAK084A07 pCMV-SPORT6 BC039869 NM_015710 Partial
HGY084436 IRAL011B12 pOTB7 BC004229 NM_015710 Partial/var
HGY086905 IRAL017E09 pOTB7 BC006311 NM_015710 Full
HGY088869 IRAL022C21 pOTB7 BC007248 NM_015710 Partial
HGY090858 IRAL027C10 pOTB7 BC010095 NM_015710 Full
HGY091375 IRAL028H07 pOTB7 BC014009 NM_015710 Partial

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE007541 W01A018O05 pENTR-TOPO IRAL017E09 BC006311 NM_015710  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR188476 ARi71D04 pGCAP10 NM_015710.3  
GCTTTGACAAGATGGCGGCAGGAGGCAGTGGCGTTGGTGGGAAGCGCAGCTCGAAAAGCG
HKR329277 RBb23D05 pGCAP1 NM_015710.3  
CCTTTGACAAGATGGCGGCAGGAGGCAGTGGCGTTGGTGGGAAGCGCAGCTCGAAAAGCG
HKR338127 RBb45F07 pGCAP1 NM_015710.3  
GCCTTTGACAAGATGGCGGCAGGAGGCAGTGGCGTTGGTGGGAAGCGCAGCTCGAAAAGC
HKR394878 RBd87D06 pGCAP10 NM_015710.3  
GCTTTTGACAAGATGGCGGCAGGAGGCAGTGGCGTTGGTGGGAAGCGCAGCTCGAAAAGC
HKR405896 RBdS014M08 pGCAP10 NM_015710.3  
GCTTTTTTTGACNNGATGGNGGNAGGNGGCCCTGNCATTGGTGGGAAGCNCANCTCGAAN
HKR471175 RBdS177P15 pGCAP10 NM_015710.3  
GCTTTGACAAGATGGCGGCAGGAGGCAGTGGCGTTGGTGGGAAGCGCAGCTCGAAAAGCG
HKR475103 RBdS187M15 pGCAP10 NM_015710.3  
GGAGTTCTTCCTTTGACAAGATGGCGGCAGGAGGCAGTGGCGTTGGTGGGAAGCGCAGCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.08.28

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170416.pl