Prev. |  KEGG KO K14840 > 

RIKEN DNA Bank Human Resource - NOP53

Gene ID NCBI Gene 29997 |  KEGG hsa:29997
Gene Symbol NOP53
Protein Name NOP53 ribosome biogenesis factor
Synonyms GLTSCR2|PICT-1|PICT1
Ortholog resource in our bank

  NOP53

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX033607 IRAK084A07 pCMV-SPORT6 BC039869 NM_015710 Partial
HGY084436 IRAL011B12 pOTB7 BC004229 NM_015710 Partial/var
HGY086905 IRAL017E09 pOTB7 BC006311 NM_015710 Full
HGY088869 IRAL022C21 pOTB7 BC007248 NM_015710 Partial
HGY090858 IRAL027C10 pOTB7 BC010095 NM_015710 Full
HGY091375 IRAL028H07 pOTB7 BC014009 NM_015710 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE007541 W01A018O05 pENTR-TOPO IRAL017E09 BC006311 NM_015710  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR188476 ARi71D04 pGCAP10 NM_015710.3  
GCTTTGACAAGATGGCGGCAGGAGGCAGTGGCGTTGGTGGGAAGCGCAGCTCGAAAAGCG
HKR329277 RBb23D05 pGCAP1 NM_015710.3  
CCTTTGACAAGATGGCGGCAGGAGGCAGTGGCGTTGGTGGGAAGCGCAGCTCGAAAAGCG
HKR338127 RBb45F07 pGCAP1 NM_015710.3  
GCCTTTGACAAGATGGCGGCAGGAGGCAGTGGCGTTGGTGGGAAGCGCAGCTCGAAAAGC
HKR394878 RBd87D06 pGCAP10 NM_015710.3  
GCTTTTGACAAGATGGCGGCAGGAGGCAGTGGCGTTGGTGGGAAGCGCAGCTCGAAAAGC
HKR405896 RBdS014M08 pGCAP10 NM_015710.3  
GCTTTTTTTGACNNGATGGNGGNAGGNGGCCCTGNCATTGGTGGGAAGCNCANCTCGAAN
HKR471175 RBdS177P15 pGCAP10 NM_015710.3  
GCTTTGACAAGATGGCGGCAGGAGGCAGTGGCGTTGGTGGGAAGCGCAGCTCGAAAAGCG
HKR475103 RBdS187M15 pGCAP10 NM_015710.3  
GGAGTTCTTCCTTTGACAAGATGGCGGCAGGAGGCAGTGGCGTTGGTGGGAAGCGCAGCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl