Prev. |  KEGG KO K14709 > 

RIKEN DNA Bank Human Resource - SLC39A3

Gene ID NCBI Gene 29985 |  KEGG hsa:29985
Gene Symbol SLC39A3
Protein Name solute carrier family 39 member 3
Synonyms ZIP-3|ZIP3
Ortholog resource in our bank

  SLC39A3

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX001955 IRAK004O19 pCMV-SPORT6 BC000815 NM_213568.2
HGX011181 IRAK027P21 pCMV-SPORT6 BC017009 NM_213568 Partial/var
HGY084296 IRAL010M08 pOTB7 BC005869 NM_144564 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR069371 ARe73H03 pKA1U5 NM_144564.4  
GGGGGCGTGGACCAGCCGCGCCGAGCGGGGCCCCCTTTGGCCGCGTCTGTGGGGTCGAGA
HKR188106 ARi70E10 pGCAP10 NM_144564.4  
GGTGGGCGGGGCGTGGACCAGCCGCGCCGAGCGGGGCCTCTCCGGGCCGCGTCTGTGGGG
HKR222321 ARiS055N09 pGCAP10 NM_144564.4  
GGCGCCGAGCGGGGCCTCTCCGGGCCGCGTCTGTGGGGTCGAGACTGCGCGGCCGTTGGG
HKR376972 RBd42H04 pGCAP10 NM_144564.4  
GAGCCGCGCCGAGCGGGGCCTCTCCGGGCCGCGTCTGTGGGGTCGAGACTGCGCGGCCGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl