Prev. |  KEGG KO K04523 > 

RIKEN DNA Bank Human Resource - UBQLN1

Gene ID NCBI Gene 29979 |  KEGG hsa:29979
Gene Symbol UBQLN1
Protein Name ubiquilin 1
Synonyms DA41|DSK2|PLIC-1|UBQN|XDRP1
Ortholog resource in our bank

  UBQLN1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY025299 IRAK063E03 pBluescriptR BC039294 NM_013438 Full/var
HGY091093 IRAL027M05 pOTB7 BC010066 NM_053067 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE043382 W01A108H14 pENTR-TOPO flj0033n13 AK027556 NM_013438  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR208313 ARiS020N01 pGCAP10 NM_013438.4  
GAGGAAGCGGTGGCTGCTGCGGATGTCGGTGTGAGCGAGCGGCGCCTGAACACACGGCGG
HKR433240 RBdS083B16 pGCAP10 NM_013438.4  
GGAAGGGACGTGGGGGAAGGGGCAGGGAGGAGGAAGCGGTGGCTGCTGCGGATGTCGGTG
HKR441609 RBdS104A09 pGCAP10 NM_013438.4  
GGGGGGAAGGGGCAGGGAGGAGGAAGCGGTGGCTGCTGCGGATGTCGGTGTGAGCGAGCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl