Prev. | 

RIKEN DNA Bank Human Resource - PRICKLE4

Gene ID NCBI Gene 29964 |  KEGG hsa:29964
Gene Symbol PRICKLE4
Protein Name prickle planar cell polarity protein 4
Synonyms C6orf49|OBTP|OEBT|TOMM6
Links

  KEGG gene

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR074028 ARe85B04 pKA1U5 NM_013397.5  
ATCCTGGATGCGAAGCTTTCCACTATGGCTTCCAGCACTGTCCCGGTGAGCGCTGCTGGC
HKR077749 ARe94G05 pKA1U5 NM_013397.5  
ATCCTGGATGCGAAGCTTTCCACTATGGCTTCCAGCACTGTCCCGGTGAGCGCTGCTGGC
HKR203506 ARiS008M18 pGCAP10 NM_013397.5  
TTGNAAGCTTTCCACNATGGCTTCCAGCACTGTCCCGGTGAGCGCTGCTGGCTCGGCTAA
HKR348170 RBb70H02 pGCAP1 NM_013397.5  
AAATGTGACCGAGGCCCATGCGAAGCTTTCCACTATGGCTTCCAGCACTGTCCCGGTGAG
HKR372103 RBd30E07 pGCAP10 NM_013397.5  
TGGCCCATGCGAAGCTTTCCACTATGGCTTCCAGCACTGTCCCGGTGAGCGCTGCTGGCT
HKR378857 RBd47C09 pGCAP10 NM_013397.5  
GCTCCACCGAGGCCCATGCGAAGCTTTCCACTATGGCTTCCAGCACTGTCCCGGTGAGCG
HKR392553 RBd81G09 pGCAP10 NM_013397.5  
GTTTCCACTATGGCTTCCAGCACTGTCCCGGTGAGCGCTGCTGGCTCGGCTAATGAAACT
HKR403152 RBdS007O16 pGCAP10 NM_013397.5  
GGGTTCCTCCACCGAGGCCCATGCGAAGCTTTCCACTATGGCTTCCAGCACTGTCCCGGT
HKR474877 RBdS187D05 pGCAP10 NM_013397.5  
GCCCATGCGAAGCTTTCCACTATGGCTTCCAGCACTGTCCCGGTGAGCGCTGCTGGCTCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.03.25

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl