RIKEN DNA Bank Human Resource

RIKEN DNA Bank Human Resource - SLC25A24

Gene ID	NCBI Gene 29957 \| KEGG hsa:29957
Gene Symbol	SLC25A24
Protein Name	solute carrier family 25 member 24
Synonyms	APC1\|SCAMC-1\|SCAMC1

Ortholog resource in our bank

  SLC25A24

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number	Clone name	Vector	Sequence submitted (DDBJ)⁽¹⁾	CDS comparison
Catalog number	Clone name	Vector	Sequence submitted (DDBJ)⁽¹⁾	Refered (NCBI mRNA)	CDS status⁽²⁾
HGY067008	IRAK167I16	pBluescriptR	BC068561	NM_013386	Full/var
HGX056350	IRAK140O14	pCMV-SPORT6	BC068010	NM_213651	Partial/var
HGY085900	IRAL014M12	pOTB7	BC014519	NM_013386	Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number	Clone name	Vector	CDS comparison
	Clone name	Vector	Refered mRNA⁽¹⁾	CDS status
	5'-terminal sequence⁽²⁾
HKR048856	ARe22C08	pKA1U5	NM_013386.3
HKR048856	GGGGCTCGGGTGGGGTCTCCGCTCCTGCGCCCTGNNTCCCTGCGCGCCGCAGCCGCAACC
HKR050401	ARe26A01	pKA1U5	NM_013386.3
HKR050401	GAGCCCGGCCTCGCGCTGGTCCCGGTCTCGCCCCGCAGCCCTCGATCTCCCGTGACTTCC
HKR051704	ARe29E08	pKA1U5	NM_013386.3
HKR051704	GGGGCTCGGGTGGGGTCTCCGCTCCTGCGCCCTGCGCCCTGCGCGCCGCAGCCGCAACCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl