Prev. | Human A to Z list > C > 

RIKEN DNA Bank Human Resource - CERS2

Gene ID (NCBI) 29956
Gene Symbol CERS2
Protein Name ceramide synthase 2
Synonyms L3|LASS2|SP260|TMSG1
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Sphingolipid signaling pathway (human)


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY081609 IRAL004A09 pOTB7 BC001357 NM_181746 Full
HGY090867 IRAL027C19 pOTB7 BC010032 NM_181746 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR366528 RBd16F08 pGCAP10 NM_181746.2  
GGGGCGGAAGAGGGAGGAGAGGCGCGGGGAGCCAGGCCTCGGGGCCTCGGAGCAACCACC
HKR475043 RBdS187K03 pGCAP10 NM_181746.2  
GGCGGGGAGCCAGGCCTCGGGGCCTCGGAGCAACCACCCGAGCAGACGGAGTACACGGAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.10.29

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_161013.pl