Prev. |  KEGG KO K01276 > 

RIKEN DNA Bank Human Resource - DPP7

Gene ID NCBI Gene 29952 |  KEGG hsa:29952
Gene Symbol DPP7
Protein Name dipeptidyl peptidase 7
Synonyms DPP2|DPPII|QPP
Ortholog resource in our bank

  DPP7

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX008070 IRAK020C22 pCMV-SPORT6 BC016961 NM_013379 Full/var
HGY091446 IRAL028K06 pOTB7 BC011907 NM_013379 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE099238 M01C048B14 pDONR221 MGC13-H07 BC011907 NM_013379  
HGE099286 M01C048D14 pDONR221 MGC13-H07 BC011907 NM_013379  
HGE099334 M01C048F14 pDONR221 MGC13-H07 BC011907 NM_013379  
HGE099382 M01C048H14 pDONR221 MGC13-H07 BC011907 NM_013379  
HGE099430 M01C048J14 pDONR221 MGC13-H07 BC011907 NM_013379  
HGE099478 M01C048L14 pDONR221 MGC13-H07 BC011907 NM_013379  
HGE099526 M01C048N14 pDONR221 MGC13-H07 BC011907 NM_013379  
HGE099574 M01C048P14 pDONR221 MGC13-H07 BC011907 NM_013379  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR049626 ARe24B02 pKA1U5 NM_013379.2  
TGGCCGCCCACGTGACGGGCGCCCGCGGAAGGCGACATGGGCTCCGCTCCCTGGGCCCCG
HKR078946 ARe97G02 pKA1U5 NM_013379.2  
GGAAGGCGACATGGGCTCCGCTCCCTGGGCCCCGGTCCTGCTGCTGGCGCTCGGGCTGCG
HKR183607 ARi59A07 pGCAP10 NM_013379.2  
TGACGTGACGGGCGCCCGCGGAAGGCGACATGGGCTCCGCTCCCTGGGCCCCGGTCCTGC
HKR184954 ARi62G10 pGCAP10 NM_013379.2  
CGGCCGGCCGATGGGAAGGCGACATGNNCTCCGCTCCNTGGGCCCNGGTCCTGCTGCTGG
HKR234331 ARiS085N19 pGCAP10 NM_013379.2  
HKR249004 ARiS122I12 pGCAP10 NM_013379.2  
GGCTCTACTGGTCTTCGCGGAGCACCGCTACTACGGGAAGTCGCTGCCGTTCGGTGCGCA
HKR364122 RBd10F02 pGCAP10 NM_013379.2  
GGCCCACGTGACGGGCGCCCGCGGAAGGCGACATGGGCTCCGCTCCCTGGGCCCCGGTCC
HKR433500 RBdS083M12 pGCAP10 NM_013379.2  
GGCCCACGTGACGGGCGCCCGCGGAAGGCGACATGGGCTCCGCTCCCTGGGCCCCGGTCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl