Prev. |  KEGG KO K00966 > 

RIKEN DNA Bank Human Resource - GMPPA

Gene ID NCBI Gene 29926 |  KEGG hsa:29926
Gene Symbol GMPPA
Protein Name GDP-mannose pyrophosphorylase A
Synonyms AAMR
Ortholog resources KEGG ortholog (KEGG orthology K00966) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY081454 IRAL003K14 pOTB7 BC007456 NM_205847
HGY093426 IRAL033J10 pOTB7 BC014266 NM_205847 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR042804 ARe07A04 pKA1U5 NM_013335.2  
GGCGGAAGGAGCTTGCAGTAGCGGGCGGCAGAGCTGGAGTGAAGGGAGCTAGTGTTTAGG
HKR188523 ARi71F03 pGCAP10 NM_013335.2  
GACCGGGGGGGAGANCTGGGCTGCTCGGAGCTAGTGTTTAGGCTTCGGGGGCATTATGNT
HKR433417 RBdS083J01 pGCAP10 NM_013335.2  
GGAGAAGACACGTGCGCGGAAGGAGCTTGCAGTAGCGGGCGGCAGAGCTGGAGTGAAGGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.20

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl