Prev. |  KEGG KO K16611 > 

RIKEN DNA Bank Human Resource - HOOK2

Gene ID NCBI Gene 29911 |  KEGG hsa:29911
Gene Symbol HOOK2
Protein Name hook microtubule tethering protein 2
Synonyms HK2
Ortholog resource in our bank

  HOOK2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX008480 IRAK021D08 pCMV-SPORT6 BC012443 NM_013312 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE092044 M01C030B20 pDONR221 MGC04-H10 BC012443 ENST00000264827  
HGE092092 M01C030D20 pDONR221 MGC04-H10 BC012443 ENST00000264827  
HGE092140 M01C030F20 pDONR221 MGC04-H10 BC012443 ENST00000264827  
HGE092188 M01C030H20 pDONR221 MGC04-H10 BC012443 ENST00000264827  
HGE092236 M01C030J20 pDONR221 MGC04-H10 BC012443 ENST00000264827  
HGE092284 M01C030L20 pDONR221 MGC04-H10 BC012443 ENST00000264827  
HGE092332 M01C030N20 pDONR221 MGC04-H10 BC012443 ENST00000264827  
HGE092380 M01C030P20 pDONR221 MGC04-H10 BC012443 ENST00000264827  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR056945 ARe42G01 pKA1U5 NM_013312.2  
GGGCGCTCTAGGCCGAGCGGGAGGTCGGGGCTGCGGGCGCTCGCTGGTGGCGGACCCGGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl