Prev. |  KEGG KO K17927 > 

RIKEN DNA Bank Human Resource - SNX15

Gene ID NCBI Gene 29907 |  KEGG hsa:29907
Gene Symbol SNX15
Protein Name sorting nexin 15
Synonyms HSAF001435
Ortholog resource in our bank

  SNX15

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY082992 IRAL007H24 pOTB7 BC009897 NM_013306 Full
HGY085893 IRAL014M05 pOTB7 BC014520 NM_013306 Full
HGY089806 IRAL024I14 pOTB7 BC012767 NM_013306 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR162169 ARi05H01 pGCAP10 NM_013306.3  
GGCGCAGGCCTGGCGAGGCGGCGGCGGGCGGAGGCTGGGCCGGAGGGGTGGGGACGGCGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl