Prev. | 

RIKEN DNA Bank Human Resource - FAM216A

Gene ID NCBI Gene 29902 |  KEGG hsa:29902
Gene Symbol FAM216A
Protein Name family with sequence similarity 216 member A
Synonyms C12orf24|HSU79274
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX008234 IRAK020J18 pCMV-SPORT6 BC020967 NM_013300 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR174403 ARi36A03 pGCAP10 NM_013300.2  
GGGGGGAGGGATGCTGGGACAGCTGCTCCCGCACACGGCTCGCGGTCTCGGCGCCGCGGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl