Prev. |  KEGG KO K16734 > 

RIKEN DNA Bank Human Resource - SAC3D1

Gene ID NCBI Gene 29901 |  KEGG hsa:29901
Gene Symbol SAC3D1
Protein Name SAC3 domain containing 1
Synonyms HSU79266|SHD1
Ortholog resource in our bank

  SAC3D1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY084068 IRAL010C20 pOTB7 BC007448 NM_013299 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR381684 RBd54D12 pGCAP10 NM_013299.3  
GCCCCGGCCGGCCTCGCGTGCCTTCCCGCAGCACTGCCGTCCCNNNNATGCTGAGCGCCC
HKR432504 RBdS081E08 pGCAP10 NM_013299.3  
GGCCTTCCCGCAGCACTGCCGTCCCCGGGATGCTGAGCGCCCACCGTCTCCCCGCAGCCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl