Prev. |  KEGG KO K15837 > 

RIKEN DNA Bank Human Resource - GPSM2

Gene ID NCBI Gene 29899 |  KEGG hsa:29899
Gene Symbol GPSM2
Protein Name G protein signaling modulator 2
Synonyms CMCS|DFNB82|LGN|PINS
Ortholog resources KEGG ortholog (KEGG orthology K15837) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY095935 IRAL039N23 pOTB7 BC027732 NM_013296

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR209227 ARiS023B03 pGCAP10 NM_013296.4  
GGGGCGGTGTTGAGACCGGCGGAGCGGCGGGACCCCTAGGTGGCGGAGGGACGCTCCGGG
HKR323322 RBb08F02 pKA1U5 NM_013296.4  
GGCCGTGACCACCCGNTCTGTCGCCCGAGGCGGCCGCCGCTGCACCTTCACCGCGTACCC
HKR416364 RBdS040P04 pGCAP10 NM_013296.4  
GGCCCGAGGCGGCCGCCGCTGCACCTTCACCGCGTACCCGGGACCCGCCCGCCCGCGGGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.20

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl