Prev. |  KEGG KO K14401 > 

RIKEN DNA Bank Human Resource - CPSF1

Gene ID NCBI Gene 29894 |  KEGG hsa:29894
Gene Symbol CPSF1
Protein Name cleavage and polyadenylation specific factor 1
Synonyms CPSF160|HSU37012|P/cl.18
Ortholog resource in our bank

  CPSF1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX024924 IRAK062F04 pCMV-SPORT6 BC028197 NM_013291 Partial/var
HGY088188 IRAL020H20 pOTB7 BC009954 NM_013291 Partial/var
HGY090720 IRAL026N08 pOTB7 BC017232 NM_013291 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR040830 ARe02B06 pKA1U5 NM_013291.2  
GGAACTGCCAGGNTGGGCGGCCGGGCGGGCGGCCGANGCGGCAGCGCGAGGCCGGGGAGG
HKR428118 RBdS070E22 pGCAP10 NM_013291.2  
GGGAACCTTCCCGCCCAGCTTCTGGGCCCGGCCGGACTGAGTTCGCTGCTGTCCCGGTTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl