Prev. |  KEGG KO K14537 > 

RIKEN DNA Bank Human Resource - GNL2

Gene ID NCBI Gene 29889 |  KEGG hsa:29889
Gene Symbol GNL2
Protein Name G protein nucleolar 2
Synonyms HUMAUANTIG|NGP1|Ngp-1|Nog2|Nug2
Ortholog resource in our bank

  GNL2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY082989 IRAL007H21 pOTB7 BC000107 NM_013285 Full/var
HGY084299 IRAL010M11 pOTB7 BC009250 NM_013285 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR056522 ARe41F02 pKA1U5 NM_013285.2  
GGCACACGTGGNTCCGGCGTGGTTTCAGGCGGGTGTCTTCGGCCGGGCTTGGGAACATAA
HKR373747 RBd34G03 pGCAP10 NM_013285.2  
GGGTTCAGGCGGGTGTCTTCGGCCGGGCTTGGGAACATAAAAGTTTGTTTCACCACGTAA
HKR392009 RBd80A09 pGCAP10 NM_013285.2  
GGCACACGTGGTCCGGCGTGGTTCAGGCGGGTGTCTTCGGCCGGGCTTGGGAACATAAAA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl