Prev. |  KEGG KO K17608 > 

RIKEN DNA Bank Human Resource - STRN4

Gene ID NCBI Gene 29888 |  KEGG hsa:29888
Gene Symbol STRN4
Protein Name striatin 4
Synonyms PPP2R6C|ZIN|zinedin
Ortholog resource in our bank

  STRN4

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY028916 IRAK072E20 pBluescriptR BC034604 NM_013403 Full
HGY084585 IRAL011H17 pOTB7 BC004910 NM_013403 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR348550 RBb71G06 pGCAP1 NM_013403.2  
TGCCCGGGGCCTCCATGATGGAGGAGCGAGCGGCCGCCGCGGTCGCCGCCGCCGCCTCCT
HKR406241 RBdS015K01 pGCAP10 NM_013403.2  
GGGGCCGGCCCCGGGGCCTCCATGATGGAGGAGCGAGCGGCCGCCGCGGTCGCCGCCGCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl