Prev. | Human A to Z list > A > 

RIKEN DNA Bank Human Resource - ANAPC2

Gene ID (NCBI) 29882
Gene Symbol ANAPC2
Protein Name anaphase promoting complex subunit 2
Synonyms APC2|RP11-350O14.5
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Ortholog resources in the DNA Bank (KEGG orthology K03349)


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX001656 IRAK004C08 pCMV-SPORT6 BC001579 NM_013366 Partial/var
HGX027655 IRAK069C07 pCMV-SPORT6 BC032503 NM_013366 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE094010 M01C035A10 pDONR221 MGC07-B05 BC032503 NM_013366  
HGE094058 M01C035C10 pDONR221 MGC07-B05 BC032503 NM_013366  
HGE094106 M01C035E10 pDONR221 MGC07-B05 BC032503 NM_013366  
HGE094154 M01C035G10 pDONR221 MGC07-B05 BC032503 NM_013366  
HGE094202 M01C035I10 pDONR221 MGC07-B05 BC032503 NM_013366  
HGE094250 M01C035K10 pDONR221 MGC07-B05 BC032503 NM_013366  
HGE094298 M01C035M10 pDONR221 MGC07-B05 BC032503 NM_013366  
HGE094346 M01C035O10 pDONR221 MGC07-B05 BC032503 NM_013366  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR044829 ARe12B05 pKA1U5 NM_013366.3  
GGCCGAGCGAATCTCGGAGTCGGTGGGTGCAGATGGNGGCGGCAGTTGTGGTGGCGGAGG
HKR218298 ARiS045M10 pGCAP10 NM_013366.3  
TGGGCCGAGCGAATCTCGGAGTCGGTGGGTGCAGATGGCGGCGGCAGTTGTGGTGGCGGA
HKR361352 RBd03G08 pGCAP10 NM_013366.3  
GGAGCGAATCTCGGAGTCGGTGGGTGCAGATGGCGGCGGCAGTTGTGGTGGCGGAGGGGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.08.28

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170416.pl