Prev. |  KEGG KO K03349 > 

RIKEN DNA Bank Human Resource - ANAPC2

Gene ID NCBI Gene 29882 |  KEGG hsa:29882
Gene Symbol ANAPC2
Protein Name anaphase promoting complex subunit 2
Synonyms APC2
Ortholog resource in our bank

  ANAPC2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX001656 IRAK004C08 pCMV-SPORT6 BC001579 NM_013366 Partial/var
HGX027655 IRAK069C07 pCMV-SPORT6 BC032503 NM_013366 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE094010 M01C035A10 pDONR221 MGC07-B05 BC032503 NM_013366  
HGE094058 M01C035C10 pDONR221 MGC07-B05 BC032503 NM_013366  
HGE094106 M01C035E10 pDONR221 MGC07-B05 BC032503 NM_013366  
HGE094154 M01C035G10 pDONR221 MGC07-B05 BC032503 NM_013366  
HGE094202 M01C035I10 pDONR221 MGC07-B05 BC032503 NM_013366  
HGE094250 M01C035K10 pDONR221 MGC07-B05 BC032503 NM_013366  
HGE094298 M01C035M10 pDONR221 MGC07-B05 BC032503 NM_013366  
HGE094346 M01C035O10 pDONR221 MGC07-B05 BC032503 NM_013366  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR044829 ARe12B05 pKA1U5 NM_013366.3  
GGCCGAGCGAATCTCGGAGTCGGTGGGTGCAGATGGNGGCGGCAGTTGTGGTGGCGGAGG
HKR218298 ARiS045M10 pGCAP10 NM_013366.3  
TGGGCCGAGCGAATCTCGGAGTCGGTGGGTGCAGATGGCGGCGGCAGTTGTGGTGGCGGA
HKR361352 RBd03G08 pGCAP10 NM_013366.3  
GGAGCGAATCTCGGAGTCGGTGGGTGCAGATGGCGGCGGCAGTTGTGGTGGCGGAGGGGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl