Prev. |  KEGG KO K00729 > 

RIKEN DNA Bank Human Resource - ALG5

Gene ID NCBI Gene 29880 |  KEGG hsa:29880
Gene Symbol ALG5
Protein Name ALG5 dolichyl-phosphate beta-glucosyltransferase
Synonyms bA421P11.2
Ortholog resource in our bank

  ALG5

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY087833 IRAL019J17 pDNR-LIB BC012531 NM_013338 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE005944 W01A014O08 pENTR-TOPO IRAL019J17 BC012531 NM_013338  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR160574 ARi01H06 pGCAP10 NM_013338.4  
GGGGCGGGCTGCCACGGCATGGAGAATGGCTCCGCTTCTGTTGCAGCTGGCGGTGCTCGG
HKR243620 ARiS109A20 pGCAP10 NM_013338.4  
GGGGCGCGCTTCCGCCTGTGTGGAGGTGCGGGATTGGGCGGGCTGCCNCGGCATGGAGAA
HKR243834 ARiS109J18 pGCAP10 NM_013338.4  
GCTAAATCCCAGAGGTTGGCCCCCTGAGGTGTGAGTGAAATGAGCTTTTGCTTTATTTTC
HKR323635 RBb09B11 pKA1U5 NM_013338.4  
GATTGGGCGGGCTGCCACGGCATGGAGAATGGCTCCGCTTCTGTTGCAGCTGGCGGTGCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl