Prev. | 

RIKEN DNA Bank Human Resource - REPIN1

Gene ID NCBI Gene 29803 |  KEGG hsa:29803
Gene Symbol REPIN1
Protein Name replication initiator 1
Synonyms AP4|RIP60|ZNF464|Zfp464
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY080757 IRAL001O21 pOTB7 BC000363 NM_014374 Full/var
HGY082521 IRAL006F01 pOTB7 BC001760 NM_014374 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE002589 W01A006H21 pENTR-TOPO IRAL006F01 BC001760 NM_014374 done
HGE017267 W01A043C19 pENTR-TOPO IRAL001O21 BC000363 NM_014374  
HGE017271 W01A043C23 pENTR-TOPO IRAL001O21 BC000363 NM_014374  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR059603 ARe49A03 pKA1U5 NM_013400.3  
GGGGGACGGGCCTGGCAGTTGTGAACTCGAACCTGCCGCTGTCGCCGCGGCGGGGCGGGG
HKR071276 ARe78D04 pKA1U5 NM_013400.3  
GCTCTTTCTTAATTTCTAGAAAAGAGTGAAGAGAGGCCTTTTCAAAGTTCGCAGGATCGG
HKR174156 ARi35G12 pGCAP10 NM_013400.3  
GAGTTGTGAACTCGAACCTGCCGCTGTCGCCGCGGCGGGGCGGGGAGCGAGAGTGGGCCG
HKR395751 RBd89G07 pGCAP10 NM_013400.3  
GACTCGAACCTGCCGCTGTCGCCGCGGCGGGGCGGGGAGCGAGAGTGGGCCGCGGAGGCC
HKR470937 RBdS177F17 pGCAP10 NM_013400.3  
GNNTTNNNAACTCNNACCTGCCGCTGTCGCCGCGGCGGGGCGGGGAGCGAGAGTGGGCCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl